Review



sgrna2  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher sgrna2
    Sgrna2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pm41673416-204-10-30?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    sgrna2 - by Bioz Stars, 2026-08
    99/100 stars

    Images



    Similar Products

    86
    Synthego Inc sgrna2
    Sgrna2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/us12590320-2306-21-26?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    sgrna2 - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    86
    Twist Bioscience tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Tobacco Rattle Virus Rna2 Ptrv2 Vectors Ptrv2 Sgrna1 Sgrna2, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/bio_rxiv__64898__2026__03__01__708793-298-0-12?v=Twist+Bioscience
    Average 86 stars, based on 1 article reviews
    tobacco rattle virus rna2 ptrv2 vectors ptrv2 sgrna1 sgrna2 - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher sgrna2
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Sgrna2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pm41673416-204-10-30?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    sgrna2 - by Bioz Stars, 2026-08
    99/100 stars
      Buy from Supplier

    92
    Addgene inc addgene plasmid
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pmc12823065-25-12-12?v=Addgene+inc
    Average 92 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-08
    92/100 stars
      Buy from Supplier

    92
    Addgene inc u6 sgrna1
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    U6 Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pmc12823065-25-6-12?v=Addgene+inc
    Average 92 stars, based on 1 article reviews
    u6 sgrna1 - by Bioz Stars, 2026-08
    92/100 stars
      Buy from Supplier

    86
    Synthego Inc sgrna2 gcuguaaugaagguccccca
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Sgrna2 Gcuguaaugaagguccccca, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pmc11652221-435-52-48?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    sgrna2 gcuguaaugaagguccccca - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    93
    Cyagen Biosciences tctcgccgactttgggcgcc agg cyagen n a mouse tfeb sgrna2 sequence
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Tctcgccgactttgggcgcc Agg Cyagen N A Mouse Tfeb Sgrna2 Sequence, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pmc12614383__hep-82-1534-s001-183-7-8?v=Cyagen+Biosciences
    Average 93 stars, based on 1 article reviews
    tctcgccgactttgggcgcc agg cyagen n a mouse tfeb sgrna2 sequence - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Addgene inc puas cas9t2agfp
    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying <t>pTRV2-AN1,</t> pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.
    Puas Cas9t2agfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sgrna2/pmc12549914__41467_2025_64448_MOESM1_ESM-57-23-25?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    puas cas9t2agfp - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying pTRV2-AN1, pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.

    Journal: bioRxiv

    Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

    doi: 10.64898/2026.03.01.708793

    Figure Lengend Snippet: a) Developmental expression patterns of AN1 and AN11 . RT-qPCR analysis was performed on flower tissues collected at different developmental stages. DPA, days postanthesis. Data are means ± SEM (n = 3). Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. (b and c) Petunia cv. Mitchell flowers were inoculated at anthesis with agrobacteria carrying pTRV2-AN1, pTRV2-AN11 or pTRV2-CHS as a control. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis (b) or RNA extraction followed by RT-qPCR analysis (c) . Data are means ± SEM ( n = 12). Significance of differences was calculated using Dunnett’s test with pTRV2-CHS as the control following one-way ANOVA (b) or two-tailed unpaired Student’s t -test (c) (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). (a and c) RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Standard errors are indicated by vertical lines.

    Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

    Techniques: Expressing, Quantitative RT-PCR, Comparison, Control, Sampling, Gas Chromatography-Mass Spectrometry, RNA Extraction, Two Tailed Test

    a) Phylogenetic tree displaying the similarity between EOBV and subgroup 4 R2R3-MYBs from other plants. Protein sequences were aligned by ClustalW, followed by neighbor-joining method with 1000 bootstraps using MEGA version 11. b) Nuclear localization of EOBV in petal epidermal cells by confocal microscopy. Petunia petals were inoculated with agrobacteria carrying EOBV-GFP or GFP-EOBV and RFP - NLS, or only RFP - NLS as a control. Bars = 10 μm. BF = bright field. NLS, nuclear localization signal. c) Expression of EOBV in different plant organs. Tissues from different organs were collected at 1100 h. RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. d) EOBV transcripts are enriched in the petal adaxial epidermis. Normalized counts in the petal adaxial epidermis (purple bars) vs. whole petal (gray bars) based on the transcriptome data from Skaliter et al . (2024) . Significance of differences was calculated by two-tailed unpaired Student’s t -test: * P ≤ 0.05. EVER, EPIDERMIS VOLATILE EMISSION REGULATOR. CAB, CHLOROPHYLL A/B BINDING PROTEIN. e) Transient suppression of EOBV in petunia cv. Mitchell flowers inoculated with agrobacteria carrying pTRV2-CHS as a control or pTRV2-EOBV. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis or RNA extraction followed by RT-qPCR analysis (inset). Data are means ± SEM ( n = 11–12). RT-qPCR data were normalized to ACTIN , and the presented data were normalized to those from pTRV2-CHS. Significance of differences between treatments was calculated by two-tailed unpaired Student’s t -test: (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). Standard errors are indicated by vertical lines.

    Journal: bioRxiv

    Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

    doi: 10.64898/2026.03.01.708793

    Figure Lengend Snippet: a) Phylogenetic tree displaying the similarity between EOBV and subgroup 4 R2R3-MYBs from other plants. Protein sequences were aligned by ClustalW, followed by neighbor-joining method with 1000 bootstraps using MEGA version 11. b) Nuclear localization of EOBV in petal epidermal cells by confocal microscopy. Petunia petals were inoculated with agrobacteria carrying EOBV-GFP or GFP-EOBV and RFP - NLS, or only RFP - NLS as a control. Bars = 10 μm. BF = bright field. NLS, nuclear localization signal. c) Expression of EOBV in different plant organs. Tissues from different organs were collected at 1100 h. RT-qPCR data were normalized to ACTIN , and the presented data were normalized to the sample with the highest expression level. Significance of differences was calculated by Tukey’s multiple comparison test following one-way ANOVA. Values with different letters are significantly different at P ≤ 0.05. d) EOBV transcripts are enriched in the petal adaxial epidermis. Normalized counts in the petal adaxial epidermis (purple bars) vs. whole petal (gray bars) based on the transcriptome data from Skaliter et al . (2024) . Significance of differences was calculated by two-tailed unpaired Student’s t -test: * P ≤ 0.05. EVER, EPIDERMIS VOLATILE EMISSION REGULATOR. CAB, CHLOROPHYLL A/B BINDING PROTEIN. e) Transient suppression of EOBV in petunia cv. Mitchell flowers inoculated with agrobacteria carrying pTRV2-CHS as a control or pTRV2-EOBV. Flowers were harvested 2 days after inoculation and subjected to localized headspace sampling followed by GC–MS analysis or RNA extraction followed by RT-qPCR analysis (inset). Data are means ± SEM ( n = 11–12). RT-qPCR data were normalized to ACTIN , and the presented data were normalized to those from pTRV2-CHS. Significance of differences between treatments was calculated by two-tailed unpaired Student’s t -test: (* P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001). Standard errors are indicated by vertical lines.

    Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

    Techniques: Confocal Microscopy, Control, Expressing, Quantitative RT-PCR, Comparison, Two Tailed Test, Binding Assay, Sampling, Gas Chromatography-Mass Spectrometry, RNA Extraction

    a) Schematic representation of the genomic sequence of EOBV and location of the three Cas9 target sites. b) Top: schematic representation of the T-DNA carrying tobacco rattle virus RNA2 (pTRV2) vectors used used for gene editing. SGP, subgenomic promoter; LB, left border; 35S-P, cauliflower mosaic virus 35S promoter; SGP, subgenomic promoter; sgRNA, single guide RNA; NOS-T, nopaline synthase terminator; RB, right border; Cas9, human co-don-optimized Cas9 gene. Bottom: targeted genomic sequences and Sanger sequencing of eobv -knockout lines. Green nucleotides, spacer sequences; red nucleotides, protospacer adjacent motif (PAM). Black arrows mark the predicted cleavage site of Cas9. Magenta box, EOBV start codon. c) Predicted EOBV protein product in eobv -knockout and wild-type (WT) lines. Functional domains are indicated by colored rectangles. Numbers denote amino acid positions. d) Representative petunia cv. Mitchell flowers 2 days postanthesis from control Cas9 and eobv lines. Bar = 1 cm.

    Journal: bioRxiv

    Article Title: The MBW complex regulates volatiles in petunia flowers: EOBV interacts with AN1 to suppress biosynthesis of phenylpropenes

    doi: 10.64898/2026.03.01.708793

    Figure Lengend Snippet: a) Schematic representation of the genomic sequence of EOBV and location of the three Cas9 target sites. b) Top: schematic representation of the T-DNA carrying tobacco rattle virus RNA2 (pTRV2) vectors used used for gene editing. SGP, subgenomic promoter; LB, left border; 35S-P, cauliflower mosaic virus 35S promoter; SGP, subgenomic promoter; sgRNA, single guide RNA; NOS-T, nopaline synthase terminator; RB, right border; Cas9, human co-don-optimized Cas9 gene. Bottom: targeted genomic sequences and Sanger sequencing of eobv -knockout lines. Green nucleotides, spacer sequences; red nucleotides, protospacer adjacent motif (PAM). Black arrows mark the predicted cleavage site of Cas9. Magenta box, EOBV start codon. c) Predicted EOBV protein product in eobv -knockout and wild-type (WT) lines. Functional domains are indicated by colored rectangles. Numbers denote amino acid positions. d) Representative petunia cv. Mitchell flowers 2 days postanthesis from control Cas9 and eobv lines. Bar = 1 cm.

    Article Snippet: Tobacco rattle virus RNA2 (pTRV2) vectors pTRV2-sgRNA1-sgRNA2 and pTRV2-sgRNA1-sgRNA3, were synthesized by Twist Bioscience (San Francisco, CA, USA), based on the pTRV2 vector with GenBank accession AF406991 .

    Techniques: Sequencing, Virus, Genomic Sequencing, Knock-Out, Functional Assay, Control